0
It will be based on the process in which it involved- for replication, transcription or translation
As a rule the bases will be expressed in Capital letters
If it is replication the sequence will A-T-G-T-T-G-G-A-C as the components of DNA is Adenine,Guianine, cytosine and thymine
But if it is for transcription it will be A-U-G-U-U-G-G-A-C as in RNA thymine is replace by uracil
Sreekala.K.P
Still curious? Ask our experts.
Chat with our AI personalities
Professor
Coach
Rene
Add your answer:
Earn +20 pts
A section of DNA has the base sequence GCTTAA the corresponding messanger RNA base sequence will be?
The corresponding messenger RNA sequence for the DNA sequence GCTTAA will be CGAAUU. This is because in RNA, adenine (A) pairs with uracil (U) instead of thymine (T) as in DNA.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
The DNA sequence for the corresponding strand would be TCCGGTAATCGGGATAAGCCCATATTTACC. This is the complementary sequence, where each nucleotide is paired with its complementary base (A with T and C with G).
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
How do you write the amino acid sequence for u-g-a-u-g-g-g-u-a-c-g-g-u-c?
The given sequence "U-G-A-U-G-G-G-U-A-C-G-G-U-C" represents the RNA sequence, not the amino acid sequence. To determine the corresponding amino acid sequence, you would need to perform translation by converting the RNA sequence into its complementary DNA sequence, then group the nucleotides into codons, and use the genetic code to find the corresponding amino acids.
What is the base sequence at the 3' end of all tRNAs?
The base sequence at the 3' end of all tRNAs is CCA. This sequence is added post-transcriptionally during tRNA processing and is important for tRNA charging with the corresponding amino acid.
