0
It will be based on the process in which it involved- for replication, transcription or translation
As a rule the bases will be expressed in Capital letters
If it is replication the sequence will A-T-G-T-T-G-G-A-C as the components of DNA is Adenine,Guianine, cytosine and thymine
But if it is for transcription it will be A-U-G-U-U-G-G-A-C as in RNA thymine is replace by uracil
Sreekala.K.P
Wiki User
∙ 12y ago
The corresponding sequence for t-a-c-a-a-c-g-t-g is a-t-g-t-t-g-c-a-c. This is determined by pairing adenine with thymine, cytosine with guanine, and vice versa.
Wiki User
∙ 14y agoWell...A pairs with T and G pairs with C. So the matching sequence would probably be...
C-T-G-C-A-T-G-A-C-C-T-A :)
Add your answer:
Earn +20 pts
A section of DNA has the base sequence GCTTAA the corresponding messanger RNA base sequence will be?
The corresponding messenger RNA sequence for the DNA sequence GCTTAA will be CGAAUU. This is because in RNA, adenine (A) pairs with uracil (U) instead of thymine (T) as in DNA.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
The DNA sequence for the corresponding strand would be TCCGGTAATCGGGATAAGCCCATATTTACC. This is the complementary sequence, where each nucleotide is paired with its complementary base (A with T and C with G).
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
How do you write the amino acid sequence for u-g-a-u-g-g-g-u-a-c-g-g-u-c?
The given sequence "U-G-A-U-G-G-G-U-A-C-G-G-U-C" represents the RNA sequence, not the amino acid sequence. To determine the corresponding amino acid sequence, you would need to perform translation by converting the RNA sequence into its complementary DNA sequence, then group the nucleotides into codons, and use the genetic code to find the corresponding amino acids.
What is the base sequence at the 3' end of all tRNAs?
The base sequence at the 3' end of all tRNAs is CCA. This sequence is added post-transcriptionally during tRNA processing and is important for tRNA charging with the corresponding amino acid.
What is the corresponding sequence to the base sequence TACCGCTT?
ATGGCGAA for DNA AUGGCGAA for RNA
What is the corresponding mRNA sequence to ATGCCCTAAGTG of an unraveled section of DNA?
The corresponding mRNA sequence to ATGCCCTAAGTG is UACGGGAUUCA. Remember to use the complementary RNA base pairs: A-U, T-A, G-C, and C-G.
What is the corresponding sequence to CTAACG?
The corresponding sequence to CTAACG is GAUUGC. This is because in RNA, adenine (A) pairs with uracil (U) instead of thymine (T).
A section of DNA has the base sequence GCTTAA the corresponding messanger RNA base sequence will be?
The corresponding messenger RNA sequence for the DNA sequence GCTTAA will be CGAAUU. This is because in RNA, adenine (A) pairs with uracil (U) instead of thymine (T) as in DNA.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
The DNA sequence for the corresponding strand would be TCCGGTAATCGGGATAAGCCCATATTTACC. This is the complementary sequence, where each nucleotide is paired with its complementary base (A with T and C with G).
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
How do you write the amino acid sequence for u-g-a-u-g-g-g-u-a-c-g-g-u-c?
The given sequence "U-G-A-U-G-G-G-U-A-C-G-G-U-C" represents the RNA sequence, not the amino acid sequence. To determine the corresponding amino acid sequence, you would need to perform translation by converting the RNA sequence into its complementary DNA sequence, then group the nucleotides into codons, and use the genetic code to find the corresponding amino acids.
What is the puorpose of anticodons?
a codon is a sequence of 3 nucleotides, the tRNA anticodons is the comlementary pairs with its corresponding mRNA codon.
In DNA what process does the corresponding sequence a-c-t-t-g to t-g-a-a-c occur?
Transcription.
What is the base sequence at the 3' end of all tRNAs?
The base sequence at the 3' end of all tRNAs is CCA. This sequence is added post-transcriptionally during tRNA processing and is important for tRNA charging with the corresponding amino acid.
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
