0
UGCAA
Wiki User
∙ 11y ago
Add your answer:
Earn +20 pts
If the base sequence of template strand is GCCATTAC what would the base sequence of the mRNA?
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
If the nucleotide or base sequence of the DNA strand used as a template for messanger RNA synthsis is ACGTT then the sequence of bases in the correspnding mRNA would be?
For a DNA strand having the code, "aac tae ggt" the corresponding rna strand would be: "UUG AU? CCA". There is no "e" pyridine, so I do not know what would pair with "e." In DNA, the purines are Adenine and Guanine, and the pairing pyrimidines are Cytosine and Thymine, respectively. Thus, in DNA, A pairs with T and G pairs with C. In rna, the pyrimidines are again Adenine and Guanine, but the pairing pyrimidines are Uracil and Cytosine respectively. In rna, A pairs with U and G pairs with C
The order of bases in a molecule of mRNA is determined by the sequence?
The base sequence of mRnas is 'determined by the base sequence of nucleotides in Dna.' The base sequence is transformed into information via the triplet codons of The Genetic Code.
What is mRNA base sequence for ATT?
The mRNA base sequence for ATT is UAA. In mRNA, adenine (A) pairs with uracil (U) and thymine (T) is replaced by uracil (U).
What is the base sequence for the mRNA start codon?
The base sequence for the mRNA start codon is AUG. It codes for the amino acid methionine and signals the initiation of protein synthesis.
A DNA strand with the base sequence tgacgca codes for a strand of mrna the mrna will have what base sequence?
The mRNA sequence generated from the DNA strand tgacgca would be acugcgu. This is because mRNA is complementary to the DNA template strand, so DNA base T pairs with mRNA base A, DNA base G pairs with mRNA base C, DNA base A pairs with mRNA base U, and DNA base C pairs with mRNA base G.
If the base sequence of template strand is GCCATTAC what would the base sequence of the mRNA?
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
If the nucleotide or base sequence of the DNA strand used as a template for messanger RNA synthsis is ACGTT then the sequence of bases in the correspnding mRNA would be?
For a DNA strand having the code, "aac tae ggt" the corresponding rna strand would be: "UUG AU? CCA". There is no "e" pyridine, so I do not know what would pair with "e." In DNA, the purines are Adenine and Guanine, and the pairing pyrimidines are Cytosine and Thymine, respectively. Thus, in DNA, A pairs with T and G pairs with C. In rna, the pyrimidines are again Adenine and Guanine, but the pairing pyrimidines are Uracil and Cytosine respectively. In rna, A pairs with U and G pairs with C
The order of bases in a molecule of mRNA is determined by the sequence?
The base sequence of mRnas is 'determined by the base sequence of nucleotides in Dna.' The base sequence is transformed into information via the triplet codons of The Genetic Code.
What is mRNA base sequence for ATT?
The mRNA base sequence for ATT is UAA. In mRNA, adenine (A) pairs with uracil (U) and thymine (T) is replaced by uracil (U).
What statement best compares the base sequence of an mRNA molecule with that of the cDNA made from the mRNA?
The base sequence of cDNA is complementary to the mRNA molecule from which it is synthesized. This means that the cDNA will have the same sequence as the mRNA, except that thymine in DNA is replaced with uracil in RNA.
What is the base sequence for the mRNA start codon?
The base sequence for the mRNA start codon is AUG. It codes for the amino acid methionine and signals the initiation of protein synthesis.
A codon is a triplet base sequence in?
DNA
What is the corresponding mRNA sequence to ATGCCCTAAGTG of an unraveled section of DNA?
The corresponding mRNA sequence to ATGCCCTAAGTG is UACGGGAUUCA. Remember to use the complementary RNA base pairs: A-U, T-A, G-C, and C-G.
What is a anyi-codon?
an anticodon is a base sequence on tRNA which is completmently to the codon on the mRNA strand.
What is the three base sequence in mRNA?
The three base sequence in mRNA is called a codon. Codons code for specific amino acids during protein synthesis. Each codon corresponds to a specific amino acid or a stop signal.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
