0
acg-att
Wiki User
∙ 11y ago
Add your answer:
Earn +20 pts
What are some complimentary words that begin with the letter N?
Complimentary words that begin with N:NobleNiceNiftyNecessaryNeatNeighborly
What are some complimentary words that start with the letter j?
Just and judicious are complimentary words. They begin with the letter j.
Complimentary words that start with the letter N?
Neat, nice, neighborly and noble are complimentary words. They begin with the letter n.
What are complimentary adjectives that start with the letter h?
Handsome, handy, helpful, heroic, honorable, honest and humble are complimentary adjectives. They begin with H.
What complimentary words begin with letter b?
Beautiful, believable and big-hearted are complimentary adjectives. Other compliments include bright, brave and brilliant.
WHAT IS THE COMPLIMENTARY STRAND TO TTAGCGGCAAT?
AATCGCCGTTA
What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?
TTCGGT
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
DNA strand that would replicate tcgagaatctcgatt?
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
What compliments TACGTT?
The complimentary DNA strand is ----> ATGCAA
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
When the DNA strand splits into two what are these two said to be A. Coded B. Complimentary C. Concise D. Contradictory?
B. Complimentary
Is a newly synthesized strand half of the original stand with newly formed complimentary half?
yep. the new double strand is one of the original strands and a new strand
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?
A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
lol i hate this question........its in meh science book
