acg-att
Complimentary words that begin with N:NobleNiceNiftyNecessaryNeatNeighborly
Just and judicious are complimentary words. They begin with the letter j.
Neat, nice, neighborly and noble are complimentary words. They begin with the letter n.
Handsome, handy, helpful, heroic, honorable, honest and humble are complimentary adjectives. They begin with H.
Beautiful, believable and big-hearted are complimentary adjectives. Other compliments include bright, brave and brilliant.
AATCGCCGTTA
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
The complimentary strand for tagtca would be atcagt. In DNA, adenine (A) binds with thymine (T) and guanine (G) with cytosine (C).
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
taacgggtac
B. Complimentary
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
The complimentary strand for the DNA sequence cttaggcttacca is gaatccgaatggt. This is determined by pairing adenine with thymine and cytosine with guanine in the double helix structure of DNA.
The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.
The complimentary strand of MRNA would be AAUUCCGG.
The complementary strand to GCCATTG would be CGGTAAC. Adenine pairs with thymine and guanine pairs with cytosine in DNA strands.
A pairs only with T, and C pairs only with G. You know this is DNA (instead of RNA) because it has T instead of U. A = Adenine, T = Thymine, C = Cytosine, and G = Guanine An example: One strand: CGATCCGA Complimentary: GCTAGGCT Now you know enough to solve the problem on your own.