0
Add your answer:
Earn +20 pts
What are some complimentary words that begin with the letter N?
Complimentary words that begin with N:NobleNiceNiftyNecessaryNeatNeighborly
What are some complimentary words that start with the letter j?
Just and judicious are complimentary words. They begin with the letter j.
Complimentary words that start with the letter N?
Neat, nice, neighborly and noble are complimentary words. They begin with the letter n.
What are complimentary adjectives that start with the letter h?
Handsome, handy, helpful, heroic, honorable, honest and humble are complimentary adjectives. They begin with H.
What complimentary words begin with letter b?
Beautiful, believable and big-hearted are complimentary adjectives. Other compliments include bright, brave and brilliant.
WHAT IS THE COMPLIMENTARY STRAND TO TTAGCGGCAAT?
AATCGCCGTTA
What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
The complimentary strand or matchig strand of DNA for tagtca would be?
The complimentary strand for tagtca would be atcagt. In DNA, adenine (A) binds with thymine (T) and guanine (G) with cytosine (C).
DNA strand that would replicate tcgagaatctcgatt?
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
When the DNA strand splits into two what are these two said to be A. Coded B. Complimentary C. Concise D. Contradictory?
B. Complimentary
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
The complimentary strand for the DNA sequence cttaggcttacca is gaatccgaatggt. This is determined by pairing adenine with thymine and cytosine with guanine in the double helix structure of DNA.
What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?
The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What would be the complimentary strand of GCCATTG?
The complementary strand to GCCATTG would be CGGTAAC. Adenine pairs with thymine and guanine pairs with cytosine in DNA strands.
What is the complimentary strand for ATTGCGT?
A pairs only with T, and C pairs only with G. You know this is DNA (instead of RNA) because it has T instead of U. A = Adenine, T = Thymine, C = Cytosine, and G = Guanine An example: One strand: CGATCCGA Complimentary: GCTAGGCT Now you know enough to solve the problem on your own.
