0
Still curious? Ask our experts.
Chat with our AI personalities
DevinI've poured enough drinks to know that people don't always want advice—they just want to talk.
Chat with Devin
FranI've made my fair share of mistakes, and if I can help you avoid a few, I'd sure like to try.
Chat with Fran
ReneChange my mind. I dare you.
Chat with Rene
Add your answer:
Earn +20 ptsQ: What element has the atomic mass of 56?
Write your answer...
Submit
Still have questions?
Continue Learning about Natural Sciences
What is the average atomic mass of iron?
The average atomic mass of iron is approximately 55.85 atomic mass units (amu). This value is calculated based on the natural abundance of its isotopes, primarily iron-56.
An unknown atom has 26 neutrons and an approximate atomic mass of 48 What is the name of this element?
This atom has 26 neutrons and an atomic mass of 48, giving it an atomic number of 22 (since atomic mass - number of neutrons = number of protons). The element with atomic number 22 is Titanium (Ti).
What is the atomic mass for magnesiam?
The atomic mass of magnesium is approximately 24.305 amu (atomic mass units).
Which element has a greater atomic mass A or B?
Element A has a greater atomic mass than element B if the atomic mass value of A is higher. The atomic mass represents the average mass of an element’s isotopes based on their abundance in nature.
What element has an atomic mass of 131?
The element with atomic mass 131 is Iodine (I)
Trending Questions
Why won't a World War 3 occur?
In which direction is China from the Prime Meridian?
What is the function of the blood type A?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Which vegetable does the human brain resemble most?
Which one has a greater mass..2 atoms of lead or 0.000000000000000000000051 mole of helium?
How is cell differentiation affected by environmental factors?
What is a role of electromagnetic waves in communication?
What are some matching cell oragnell and there functions?
How is the heat flow the same in oceanic and continental?
What are the names of the lands that you visit on the other planets?
What group followed the cattleman to the dust bowl?
What happens to seeds if conditions are not favorable for growth?
What is a mixed semidiurnal tide?
Do little girl have big Adam's apple?
How do proteins and other chemicals synthesized in the soma get to the synaptic knob?
Do storms or other climatic conditions exist on venus?
What are the long term effects on muscles that visibly spasm due to nerve damage Do they wear themselves out Looks like calves are moving all the time Nerve damage caused by herniated discs?
Is the periodic table the elements or fire water air and earth?
How you measure a petrol by ml or L?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.