0
Add your answer:
Earn +20 pts
A DNA strand with the sequence AAC GTA ACG what is the sequence of the mRNA molecule synthesized?
UUG CAU UGC
How many hundreds to 700 ones?
700 ones = 7 hundreds
What are the different codons for leucine and proline?
LeucineCUUCUCCUACUGUUAUUGProlineCCUCCCCCACCG
How many mRNA sequences can code for the simple tripeptide sequence leu-met-tyr?
12: UUA-AUG-UAU UUA-AUG-UAC UUG-AUG-UAU UUG-AUG-UAC CUU-AUG-UAU CUU-AUG-UAC CUC-AUG-UAU CUC-AUG-UAC CUA-AUG-UAU CUA-AUG-UAC CUG-AUG-UAU CUG-AUG-UAC
What is the difference between one amino acid and another is the?
Assuming that you are talking about the amino acids that are synthesized from tRNA, the difference between one amino acid and another is the 3 letter RNA sequence that calls for the acid: UUG would call for one acid, while AAC will most likely call for another.
If the strand of DNA has the nucleotides TACCGGACCTGAAGT what would the mRNA strand be?
First of all, it is codons,not condons. MRNA would have uug auc cca. If I am not incorrect, you only use the term codons for MRNA, not in the actual DNA strand. The Anticodons would then be in the TRNA, which codes for the Amino Acids needed by the cells.
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.
What order of bases on mRNA will match a sequence on tRNA of UUA?
If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.
What determines where on the DNA molecule transcription begins and where it ends?
I think you are referring to translation - translation is the process of replicating the DNA sequence in order to produce a code for the production of a particular protein, known as an mRNA strand. This code is read in sequences of three bases known as codons. The beginning and end of the mRNA strand is determined by start and stop codons. Start codons, unlike stop codons, also need nearby sequences and initiation factors in order to begin translation. Start codons include base sequences of usually AUG or possibly GUG or UUG depending on the organism. There are three stop codons and these are UAG, UGA and UAA
How arrangement of codons in the genetic code minimize the impact of mutations?
Based on the DNA or RNA, based on the organism and based on the process of RNA and DNA the arrangement of codons will occur. During translation process in mRNA the tRNA's anticodon region comes and binds to the start codon ( AUG, GUG, UUG) of the mRNA where the translation process initiated and the process was and at the stop codon ( UAG, UAA, UGA) region the translation process was terminated. From organism to organism the arrangement of the codons will changed based on the number of basepairs.
What rhymes with hug gable?
aug gable bug gable cug gable dug gable eug gable fug gable gug gable hug gable iug gable jug gable kug gable lug gable mug gable nug gable oug gable pug gable qug gable rug gable sug gable tug gable uug gable vug gable wug gable xug gable yug gable zug gable -Your Welcome Sarah (WITH AN H :D)
The start codon is?
mRNA sequences ATG and AUG. They start coding for an amino acid and begin the protein synthesis.
