0
Add your answer:
Earn +20 pts
A DNA strand with the sequence AAC GTA ACG what is the sequence of the mRNA molecule synthesized?
UUG CAU UGC
What are the different codons for leucine and proline?
LeucineCUUCUCCUACUGUUAUUGProlineCCUCCCCCACCG
What does MCH mean and what if it is at 32.3 uug?
MCH stands for Mean Corpuscular Hemoglobin, which measures the average amount of hemoglobin in each red blood cell. A MCH value of 32.3 uug (micrograms) suggests a normal hemoglobin content within the red blood cells. It is important to consider this value in conjunction with other blood parameters for a comprehensive assessment of the blood status.
How many hundreds to 700 ones?
700 ones = 7 hundreds
AAC would bind with what anticodon?
AAC would bind with the anticodon UUG in tRNA during protein synthesis.
What is the difference between one amino acid and another is the?
Assuming that you are talking about the amino acids that are synthesized from tRNA, the difference between one amino acid and another is the 3 letter RNA sequence that calls for the acid: UUG would call for one acid, while AAC will most likely call for another.
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
Codons: AUG - UUC - GUU - AAC - GAC - CAA - AUU - UAA Anticodons: UAC - AAG - CAA - UUG - CUG - GUU - UAA - AUU
There can be more than one for the same amino acid?
Yes, multiple codons can code for the same amino acid in the genetic code. This redundancy in the genetic code is known as degeneracy. For example, the amino acid leucine is specified by six different codons: UUA, UUG, CUU, CUC, CUA, and CUG.
How many mRNA sequences can code for the simple tripeptide sequence leu-met-tyr?
There are 6 possible mRNA sequences that can code for the simple tripeptide sequence leu-met-tyr. This is because each amino acid is encoded by a specific three-nucleotide codon, and there are multiple codons that can code for each amino acid.
What codes for three amino acids?
Here are the codes for three amino acids: Leucine: UUA, UUG, CUU, CUC, CUA, CUG Glutamine: CAA, CAG Arginine: CGU, CGC, CGA, CGG, AGA, AGG
How many reading frames are possible if this molecule is translated in vitro?
There are 6 possible reading frames when translating a molecule in vitro. This is because translation can start from any of the three possible start codons (AUG, GUG, UUG) on either the forward or reverse strand, resulting in 6 reading frames.
Does translation always begin with a AUG codon?
No, translation does not always begin with an AUG codon. While the AUG codon is considered the start codon in most cases, there are exceptions where other codons such as GUG or UUG can also initiate translation.
