answersLogoWhite

0

There are no words in the official Scrabble dictionary that end with UUG.

User Avatar

Wiki User

13y ago

What else can I help you with?

Continue Learning about Games
Related Questions

A DNA strand with the sequence AAC GTA ACG what is the sequence of the mRNA molecule synthesized?

UUG CAU UGC


What role does the uug amino acid play in protein synthesis?

The uug amino acid serves as a building block in protein synthesis, where it is incorporated into the growing protein chain according to the genetic code provided by mRNA.


What are the different codons for leucine and proline?

LeucineCUUCUCCUACUGUUAUUGProlineCCUCCCCCACCG


What does MCH mean and what if it is at 32.3 uug?

MCH stands for Mean Corpuscular Hemoglobin, which measures the average amount of hemoglobin in each red blood cell. A MCH value of 32.3 uug (micrograms) suggests a normal hemoglobin content within the red blood cells. It is important to consider this value in conjunction with other blood parameters for a comprehensive assessment of the blood status.


How many hundreds to 700 ones?

700 ones = 7 hundreds


AAC would bind with what anticodon?

AAC would bind with the anticodon UUG in tRNA during protein synthesis.


What is the difference between one amino acid and another is the?

Assuming that you are talking about the amino acids that are synthesized from tRNA, the difference between one amino acid and another is the 3 letter RNA sequence that calls for the acid: UUG would call for one acid, while AAC will most likely call for another.


What are the alternative start codons used in protein synthesis?

In addition to the commonly used start codon AUG, alternative start codons such as GUG and UUG can also initiate protein synthesis.


What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?

Codons: AUG - UUC - GUU - AAC - GAC - CAA - AUU - UAA Anticodons: UAC - AAG - CAA - UUG - CUG - GUU - UAA - AUU


Is AUG always the start codon in genetic sequences?

No, AUG is not always the start codon in genetic sequences. While it is the most common start codon, there are other start codons such as GUG and UUG that can initiate protein synthesis in certain organisms.


There can be more than one for the same amino acid?

Yes, multiple codons can code for the same amino acid in the genetic code. This redundancy in the genetic code is known as degeneracy. For example, the amino acid leucine is specified by six different codons: UUA, UUG, CUU, CUC, CUA, and CUG.


How many mRNA sequences can code for the simple tripeptide sequence leu-met-tyr?

There are 6 possible mRNA sequences that can code for the simple tripeptide sequence leu-met-tyr. This is because each amino acid is encoded by a specific three-nucleotide codon, and there are multiple codons that can code for each amino acid.