0
RNA (mRNA) copy the genetic code from the DNA, which is produced after the DNA transcription happened.
RNA bring that genetic code to outside the nucleus and continue the protein synthesize. DNA can't leave the nucleus
Wiki User
∙ 14y ago
Wiki User
∙ 13y agodsRNA is a double stranded RNA, i.e the RNA which is having two strands. This phenomenon is seen in viruses only. The double-stranded (ds)RNA viruses represent a diverse group of viruses that vary widely in host range (humans, animals, plants, fungi, and bacteria), genome segment number (one to twelve), and virion organization (T-number, capsid layers, or turrets). Members of this group include the rotaviruses, renowned globally as the most common cause of gastroenteritis in young children, and bluetongue virus,[6][7] an economically important pathogen of cattle and sheep. In recent years, remarkable progress has been made in determining, at atomic and sub nano meteric levels, the structures of a number of key viral proteins and of the virion capsid of several dsRNA viruses, highlighting the significant parallels in the structure and replicative processes of many of these viruses.
dsRNA viruses:
§ Family Birnaviridae
§ Family Chrysoviridae
§ Family Cystoviridae
§ Family Hypoviridae
§ Family Partitiviridae
§ Family Reoviridae - includes Rotavirus
§ Family Totiviridae
§ Endornavirus
Wiki User
∙ 10y agoDNA and RNA are strands of nucleotides. DNA is a double-stranded nucleotide, and RNA is a single-stranded nucleotide.
Both DNA and RNA are known as nucleic acids. DNA in most cases has control on the genetic information of the cell where as RNA is produced by DNA strands to perform specific functions.
Wiki User
∙ 15y agoA strand of something usually is a strip of something
eg. A strand of hair
Wiki User
∙ 9y agoNo. Only DNA is double stranded ...
that's so it's second function of self-replication will work.
Add your answer:
Earn +20 pts
Explain how DNA replication takes place?
An enzyme unzips a DNA stand and a separate strand without base pairs come sup and matches it with the proper ones (A-U)( C-G) making RNA which goes to a ribosome outside the nucleus, makes a protein, makes a new strand of DNA and the other strand re zips with the new DNA strand.
What is the importance of the base pairing in DNA?
A mismatched base would mean a mutation of the genetic code for the RNA strand. The wrong amino acid would be produced and then the wrong protein. This would result in a defect or maybe a disease or death depending on how many other normal cells are present.
What is the role of formaldehyde and formamide in RNA gel electrophoresis?
Denatures the RNA
What is the difference between an amino acid and RNA?
RNA is a polymer of ribonucleic acids. Amino acids are the monomers of proteins.
How is genetic information coded in DNA?
DNA contains the code for synthesizing proteins. DNA transcribes itself into MRNA (memory RNA), which then leaves the nucleus and translates into TRNA (Transfer RNA) which goes around the cell to retrive the amino acids that were coded into the DNA. It comes back to the MRNA which is now attached to a ribosome and proteins are created.
What molecule builds the new strand of RNA during transcription?
RNA polymerase builds the new strand of RNA during transcription. It catalyzes the formation of phosphodiester bonds between nucleotides to create the complementary RNA strand based on the DNA template strand.
What is the enzyme that uses one strand of DNA as a template to assemble nucleotides into a strand of RNA?
RNA polymerase is the enzyme that uses one strand of DNA as a template to assemble nucleotides into a strand of RNA during transcription.
What enzyeme helps a cell to make a strand of rna?
RNA polymerase is the enzyme responsible for synthesizing RNA strands during transcription in a cell. It reads the DNA template strand and adds complementary RNA nucleotides to form an RNA strand.
Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?
Yes, that's correct. Transcription is the process by which the genetic information in a segment of DNA is used to create a complementary RNA strand. This RNA molecule can then be used to direct the synthesis of proteins in a cell.
Why is RNA needed to create proteins?
RNA is a single-stranded structure that is copied from an unzipped DNA strand identically, this is called transcription. The RNA strand contains the complementary base pairs for the DNA sequence. The DNA strand has sections that code for specific proteins, so when the RNA strand is created from the DNA, the RNA strand is then able to recreate the sequence that codes for the proteins. The RNA strand leaves the nucleus, via a nuclear pore, and enters the cytoplasm. In the cytoplasm the RNA strand binds to two Ribosomal subunits, and translation is carried out, producing proteins.
What enzyme is responsible for decodingthe DNA strand into an mRNA?
The enzyme responsible for decoding the DNA strand into an mRNA is called RNA polymerase. It catalyzes the synthesis of mRNA during transcription by matching complementary RNA nucleotides with the DNA template strand.
What is the process by which a molecule of DNA is copied into a strand of RNA occurs where?
The process by which a molecule of DNA is copied into a strand of RNA is called transcription. It occurs in the nucleus of a cell and involves the enzyme RNA polymerase, which reads one strand of the DNA molecule and synthesizes a complementary RNA strand. This new RNA molecule then serves as a template for protein synthesis.
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
Is influenza single strand or double strand RNA?
Influenza virus has a segmented, single-stranded RNA genome.
What nitrogenous base does adenine pair with in an RNA strand?
In an RNA strand, adenine (A) pairs with uracil (U).
What RNA strand is produced from DNA?
messenger RNA (mRNA)
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
