0
RNA (mRNA) copy the genetic code from the DNA, which is produced after the DNA transcription happened.
RNA bring that genetic code to outside the nucleus and continue the protein synthesize. DNA can't leave the nucleus
Wiki User
∙ 13y ago
Wiki User
∙ 12y agodsRNA is a double stranded RNA, i.e the RNA which is having two strands. This phenomenon is seen in viruses only. The double-stranded (ds)RNA viruses represent a diverse group of viruses that vary widely in host range (humans, animals, plants, fungi, and bacteria), genome segment number (one to twelve), and virion organization (T-number, capsid layers, or turrets). Members of this group include the rotaviruses, renowned globally as the most common cause of gastroenteritis in young children, and bluetongue virus,[6][7] an economically important pathogen of cattle and sheep. In recent years, remarkable progress has been made in determining, at atomic and sub nano meteric levels, the structures of a number of key viral proteins and of the virion capsid of several dsRNA viruses, highlighting the significant parallels in the structure and replicative processes of many of these viruses.
dsRNA viruses:
§ Family Birnaviridae
§ Family Chrysoviridae
§ Family Cystoviridae
§ Family Hypoviridae
§ Family Partitiviridae
§ Family Reoviridae - includes Rotavirus
§ Family Totiviridae
§ Endornavirus
Wiki User
∙ 10y agoDNA and RNA are strands of nucleotides. DNA is a double-stranded nucleotide, and RNA is a single-stranded nucleotide.
Both DNA and RNA are known as nucleic acids. DNA in most cases has control on the genetic information of the cell where as RNA is produced by DNA strands to perform specific functions.
Wiki User
∙ 15y agoA strand of something usually is a strip of something
eg. A strand of hair
Wiki User
∙ 9y agoNo. Only DNA is double stranded ...
that's so it's second function of self-replication will work.
Add your answer:
Earn +20 pts
Explain how DNA replication takes place?
An enzyme unzips a DNA stand and a separate strand without base pairs come sup and matches it with the proper ones (A-U)( C-G) making RNA which goes to a ribosome outside the nucleus, makes a protein, makes a new strand of DNA and the other strand re zips with the new DNA strand.
What is the importance of the base pairing in DNA?
A mismatched base would mean a mutation of the genetic code for the RNA strand. The wrong amino acid would be produced and then the wrong protein. This would result in a defect or maybe a disease or death depending on how many other normal cells are present.
What is the role of formaldehyde and formamide in RNA gel electrophoresis?
Denatures the RNA
What is the difference between an amino acid and RNA?
RNA is a polymer of ribonucleic acids. Amino acids are the monomers of proteins.
The two main types of flow of the genetic information are?
1.central dogma/unidirectional flow of information DNA to rna to proteins 2.central dogma reverse rna to DNA to rna to proteins e.g.in hiv
Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?
Yes. The strand of RNA is messenger RNA, mRNA.
What molecule builds the new strand of RNA during transcription?
RNA Polymerase plays the largest role in unzipping the DNA strand and then synthesizing the RNA strand.
Is influenza single strand or double strand RNA?
It is single stranded RNA. Importantly, it is also a segmented genome that allows it to have large genetic diversity.
What enzyme is responsible for decodingthe DNA strand into an mRNA?
RNA Polymerase is the enzyme responsible for creating a strand of RNA.
Why is RNA needed to create proteins?
RNA is a single-stranded structure that is copied from an unzipped DNA strand identically, this is called transcription. The RNA strand contains the complementary base pairs for the DNA sequence. The DNA strand has sections that code for specific proteins, so when the RNA strand is created from the DNA, the RNA strand is then able to recreate the sequence that codes for the proteins. The RNA strand leaves the nucleus, via a nuclear pore, and enters the cytoplasm. In the cytoplasm the RNA strand binds to two Ribosomal subunits, and translation is carried out, producing proteins.
Is DNA a single strand of nucleotides?
No, DNA, from difference with the RNA, is a double strand of nucleotides. DNA, double strand (hence the double helix nickname). RNA, single strand.
What is the enzyme that uses one strand of DNA as a template to assemble nucleotides into a strand of RNA?
RNA Polymerase
What RNA strand is produced from DNA?
messenger RNA (mRNA)
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
What is a single strand of rna that loops back on itself?
Transfer RNA (tRNA) is a single strand that loops back on itself.
