0
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
Wiki User
∙ 14y ago
lol i hate this question........its in meh science book
Wiki User
∙ 13y ago
Wiki User
∙ 14y agoThe complementary strand would be:
GAATCCGAATGGT
Add your answer:
Earn +20 pts
Why can you predict the base sequence of one stand in a molecule of DNA if you know the sequence of the other stand?
DNA is made up four nucleotide bases,a pentose sugar and a phosphate. The four nucleotides are adenine, guanine, cytosine and thymine. Due to the nature of these molecules they fall into two groups called purines ( adenine an guanine) and pyrimidines ( cytosine and thymine). The bases have complimentary base pairing causing the double helix shape of DNA. adenine always bonds with thymjine and guanine with cytosine. So you can predict what the base sequence of one strand the other strand will be the opposite base pairing, for example if you know that a strand is AGAACTG the complimentary strand is TCTTGAC.
How do you find a complimentry strand of DNA?
DNA usually comes in a double stranded helix, but if there is only one strand provided, complimentary base pairing occurs. Adenine and Thymine pair, as do Guanine and Cytosine. Given a sequence of DNA, using this, you can find its complementary strand.
Why can you predict the base sequence of one strand in a molecule of DNA if you know the sequence of the others strand?
in DNA, each base pairs up with only one other base
If a strand of DNA were composed of the base sequence ATCG what would be the sequence of it opposing base pairs?
TAGC
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What would the complementary strand of DNA be for the sequence of the base Cttaggcttacca?
lol i hate this question........its in meh science book
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
Why can you predict the base sequence of one stand in a molecule of DNA if you know the sequence of the other stand?
DNA is made up four nucleotide bases,a pentose sugar and a phosphate. The four nucleotides are adenine, guanine, cytosine and thymine. Due to the nature of these molecules they fall into two groups called purines ( adenine an guanine) and pyrimidines ( cytosine and thymine). The bases have complimentary base pairing causing the double helix shape of DNA. adenine always bonds with thymjine and guanine with cytosine. So you can predict what the base sequence of one strand the other strand will be the opposite base pairing, for example if you know that a strand is AGAACTG the complimentary strand is TCTTGAC.
How do you find a complimentry strand of DNA?
DNA usually comes in a double stranded helix, but if there is only one strand provided, complimentary base pairing occurs. Adenine and Thymine pair, as do Guanine and Cytosine. Given a sequence of DNA, using this, you can find its complementary strand.
If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?
The sequence on the strand of the helix is TACCGGATC.
What is the relationship of the two DNA strands to each other?
The two strands in a DNA molecule (the polynucleotides) are complementary to each other. This means that the base sequence in one strand determines the base sequence in the other strand. This happens because of specific base pairing. An adenine in one strand always pairs with a thymine in the other strand, and a cytosine in one strand always pairs with a guanine in the other strand. So if you know the base sequence in one strand of the DNA yoiu can work out the sequence in the complementary strand. See: http://www.phschool.com/science/biology_place/biocoach/dnarep/basepair.htmlDNA strands run anti-parallel from one another, and have a double helix structure. The strands are held together by hydrogen bonds between base pairs that are weak individually, but collectively strong.
Why can you predict the base sequence of one strand in a molecule of DNA if you know the sequence of the others strand?
in DNA, each base pairs up with only one other base
A DNA strand with the base sequence tgacgca codes for a strand of mrna the mrna will have what base sequence?
Remember that in rna Uracil replaces Thymine so ACUGCGU.
If a strand of DNA were composed of the base sequence ATCG what would be the sequence of it opposing base pairs?
TAGC
What is the complementary base sequence of DNA strand?
TGCA
If one strand of DNA has a nucleotide base sequence of tcaggtccat?
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
